Skip to content

Transcription and Translation

Transcribe DNA sequences into RNA or translate into protein sequences according to the specified reading frame and code table.

1) Transcription

  • Purpose: Convert thymine T in DNA to uracil U according to the specified chain direction to obtain an uppercase RNA sequence for checking transcript products.
  • Method: Replace T with U; reverse-strand transcription first takes the reverse complement.
  • API: dnakit.ops.transcribe(sequence[required], strand[optional]).
  • Input: One DNASequence is required; strand optional "forward" or "reverse", forward chain is used by default.
  • Output: Returns the transcribed RNA string.
  • Example code:
from dnakit import DNASequence
from dnakit.ops import transcribe

seq = DNASequence("ATGGGCTAA")
print(transcribe(seq))
  • Example output:
AUGGGCUAA

2) Translation

  • Purpose: Translate DNA or RNA into protein sequences according to the specified chain direction, reading frame and genetic code table, used to check coding regions and amino acid sequences.
  • Method: Read codons in the selected frame and code table, applying stop and ambiguity policies.
  • API: dnakit.ops.translate(sequence[required], frame[optional], table[optional], strand[optional], stop_policy[optional], unknown_policy[optional], incomplete_policy[optional]).
  • Input: Required DNASequence or normalized uppercase DNA/RNA string; optional strand, frame, table, stop codon policy, ambiguous codon policy, and incomplete codon policy.
  • Output: Returns the translated amino-acid sequence as a string.
  • Example code:
from dnakit import DNASequence
from dnakit.ops import translate

seq = DNASequence("ATGGGCTAA")
print(translate(seq))
  • Example output:
MG*

3) Translate forward reading frames and find the longest ORF

  • Purpose: Translate forward reading frames and find the longest ORF.
  • Method: Translate the three forward frames with the standard genetic code and compare uninterrupted protein segments.
  • API： dnakit.databases.dna_translate_reading_frames(*, operation=None, sequence, frame=None, genetic_code=None, verbose=True)
  • Input: Provide sequence.
  • Output: Returns a mapping with sequence_length, frames, best_frame, best_orf and related fields.
  • Example code:
import dnakit

result = dnakit.databases.dna_translate_reading_frames(
    operation='translate_reading_frames',
    sequence='ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG',
    verbose=False,
)
print(result)
  • Example output: The response has the following shape; records depend on the input and source.

Response-shape excerpt; <…> denotes type placeholders, not a captured query result.

{
  "sequence_length": "<integer>",
  "frames": "<object>",
  "best_frame": "<integer>",
  "best_orf": "<string>",
  "best_orf_length_aa": "<integer>"
}

Full parameters and usage notes